keyboard_arrow_up
abril 2022

Mortalidad de vacas y vaquillonas Holstein por miositis gangrenosa de origen clostridial.

Vet. Arg. – Vol.  XXXIX – Nº 408 – Abril 2022.
Koval, A.1, Di Paolo, J.1, Ferreyra, A.1, Benedetto, E.1, Coppola, P.1, Garraza, M.E.2, Ledesma Arlettaz, R.2

Resumen
Se describe un brote de miositis gangrenosa post parición, con mortalidad, en vacas y vaquillonas de raza Holstein en un tambo próximo a la localidad de Brinkmann, Provincia de Córdoba, entre julio y agosto de 2021. Se remitieron muestras de músculo afectado al laboratorio, con un diagnóstico presuntivo de Mancha o Carbunclo Sintomático (C. chauvoei), pero el aislamiento y la posterior identificación confirmaron Clostridium novyi toxinotipo A.
Palabras clave: Mortalidad de vacas, gangrena, miositis, clostridial.

Mortality of Holstein cows and heifers due to gangrenous myositis of clostridial origin.
Summary

An outbreak of postpartum gangrenous myositis, with mortality, is described in Holstein cows and heifers in a dairy farm near the town of Brinkmann, Province of Córdoba, between July and August 2021. Samples of affected muscle were sent to the laboratory, with a presumptive diagnosis of “Black leg” (C. chauvoei), but the isolation and subsequent identification confirmed Clostridium novyi toxinotype A.
Keywords: Cows mortality, myositis, gangrene, clostridial.
1Biogénesis Bagó
2Actividad privada
ariel.koval@biogenesisbago.com 

Introducción
La miositis gangrenosa más relevante a nivel mundial que afecta al bovino es la “Mancha” producida por Clostridium chauvoei1. Es una gangrena de tipo endógeno, donde las esporas del clostridio se alojan en los tejidos de las grandes masas musculares y permanecen latentes hasta que se producen las condiciones de baja tensión de oxígeno que permiten su germinación y el desencadenamiento de la enfermedad. Los factores predisponentes descriptos capaces de inducir esa baja tensión de oxígeno a nivel tisular suelen ser los traumatismos en las grandes masas musculares y una alta tasa de crecimiento de estos tejidos2. En nuestro País esta enfermedad fue preponderante hasta la década de 1980, donde comenzó un proceso de mejora debido a la aplicación creciente de vacunas por parte de Médicos Veterinarios y ganaderos como también por los controles oficiales de los biológicos por parte del SENASA3-4.  De esta forma, los grandes brotes de “Mancha” tan frecuentes en el pasado dejaron de ser un problema en rodeos vacunados.

Pero existen otros clostridios capaces de producir cuadros de miositis gangrenosas muy similares, por lo general de tipo exógena, es decir, que las esporas ingresan al animal a través de heridas contaminadas con tierra o materia fecal, o en otros casos de forma iatrogénica por procedimientos quirúrgicos o aplicación de inyectables sin las condiciones de asepsia requeridas.

La toma de muestras de animales no recientemente muertos, con la invasión de clostridios que son habitantes normales del intestino, pueden confundir al Veterinario y al laboratorista, dando lugar a diagnósticos erróneos5.

La capacidad de estos microorganismos de esporular les permite sobrevivir muchos años en la tierra hasta encontrar condiciones adecuadas para germinar, pasar a la forma vegetativa, multiplicarse activamente y producir potentes toxinas que matan al animal para, finalmente, esporular nuevamente y perpetuarse en la naturaleza.

El diagnóstico de los clostridios es complejo por requerir medios de cultivo especiales y condiciones de anaerobiosis para su cultivo, antitoxinas o metodologías moleculares para poder tipificar a la mayoría de las especies y, fundamentalmente, personal entrenado.

La mejora en la calidad de las vacunas y su aplicación masiva ha hecho disminuir la demanda de diagnóstico para estas enfermedades. A esto se le suman los costos y la capacitación requerida para poder aislar y tipificar estos microorganismos. La sumatoria de estos factores atentan para que jóvenes profesionales se interesen por esta disciplina, por lo que cada vez son menos los laboratorios con capacidad de aislar y tipificar este grupo de bacterias.

En este caso en particular, las categorías afectadas (animales mayores de 2 años) y la presencia de edema gelatinoso en las lesiones hicieron sospechar de Clostridium novyi 6. La toxina Alfa producida por los tipos A y B de C. novyi produce un extenso edema gelatinoso característico en el animal afectado y en animales de laboratorio inoculados experimentalmente (fotos 1 y 2).

Foto 1: edema gelatinoso en bovino .

Foto 2: edema en ratón inoculado experimentalmente

Se describe la metodología utilizada para el cultivo, aislamiento y tipificación que permitió identificar al agente causal como C. novyi toxinotipo A.

Materiales y métodos

Descripción de los casos y toma de las muestras
Se trató de un tambo próximo a la localidad de Brinkmann, Provincia de Córdoba, con 270 animales de raza Holstein, entre vacas y vaquillonas, de las cuales murieron con sintomatología 7 animales

El primer caso fue una vaca que 6 días después de su tercera parición presentó inflamación marcada en el miembro posterior derecho y renguera muriendo a las pocas horas a pesar de recibir tratamiento antibiótico (Ceftiofur) y antiinflamatorio (Meloxicam). No se efectuó necropsia a este animal. Pocos días después murió una vaquillona 5 días posteriores a su primer parto que fue normal, presentando la misma sintomatología. Sobre este animal se practicó necropsia y se remitieron muestras de músculo afectado en recipientes estériles con glicerol al 50% en agua para cultivo bacteriológico.

Por problemas en el transporte las muestras obtenidas un jueves se procesaron recién el lunes. Ante la sospecha de “Mancha” el establecimiento decidió revacunar a todas las vacas en ordeñe con vacunas que contenían C. chauvoei. Durante el tiempo transcurrido entre la confirmación diagnóstica y la aplicación a todo el rodeo de 2 dosis de vacuna* conteniendo toxoide Alfa de C. novyi murieron 5 animales más. Luego de vacunados los animales con 2 dosis no se presentaron más muertes.
*Policlostrigen, Biogénesis Bagó.

Procesamiento de muestras y técnicas de siembra
Cultivo
Las muestras se procesaron en condiciones de esterilidad en cabina de seguridad biológica. Se tomaron pequeños trozos de centro de cada muestra y se sembraron en caldo Tarozzi y placas de agar sangre y agar yema de huevo (recientemente preparadas, con doble concentración de agar y bien secas).

Observación microscópica (Tinción de Gram)
Se tomaron pequeños trozos de músculo y se realizaron improntas sobre portaobjetos. Las mismas se fijaron con calor y se tiñeron con la coloración de Gram. Se secaron y observaron al microscopio con objetivo de inmersión (100 X).

Inoculación experimental
Se inoculó un cobayo para intentar reproducir experimentalmente la enfermedad y las lesiones. Para ello se le inyectaron 0,5 mL del sobrenadante de un cultivo en caldo Tarozzi por vía intramuscular en la pata derecha.

Tipificación por seroneutralización
Se efectuó la tipificación clásica para C.novyi, utilizando antitoxinas Alfa y Beta de referencia. Se separó el sobrenadante de un cultivo de 24 hs, filtrado por 0.22 u y se congeló a – 90 °C hasta la realización de la prueba.

En 2 tubos plásticos se combinaron muestras del cultivo filtrado (0,5 mL) con antitoxinas Alfa (0,5 mL, tubo 1) y Beta (0,5 mL, tubo 2) de Clostridium novyi. Como control se empleó agua peptonada (0,5 mL) en combinación con la muestra de cultivo filtrado (0,5 mL, tubo 3). Los 3 tubos se incubaron 30 minutos a 37 °C en baño térmico. Con cada combinación se inocularon 2 ratones por vía intravenosa con 0.2 mL y se observaron durante 72 horas.

Reacción de PCR
La reacción de PCR se realizó a partir de DNA total extraído con kit PURO-Bacteria DNA de PB-L, usando los siguientes pares de primeras:

α-Toxin CNToxA-F ………  5’ – GGTGCGATTCAAGAGGCCACA – 3’

CNToxA-R ……… 5’ – CGCTCCTAGCAGTCCCGAAAT – 3’

β-Toxin CNToxβ2-F …….  5’ – GCTACTGAGACTATGCACA – 3’

CNToxβ2-R …….  5’ – GCTATATCTTGAAGTGTTAACTTA – 3’

Cada reacción de amplificación se llevó a cabo en un volumen de 40 μl., usando el kit TaqPegasus (PB-L) en un termociclador Mastercycler Personal (Eppendorf).

El set de primers CNToxA-F / CNToxA-R amplifica un fragmento de 252 pb del gen codificante de la α-toxina. Las condiciones establecidas fueron una desnaturalización inicial de 95°C por 3 min., seguidos por 30 ciclos de 95°C por 1 min., 45°C por 45 seg. y 72°C por 30 seg. Por último, una extensión final a 72°C por 3 minutos.

El set de primers CNToxβ2-F / CNToxβ2-R amplifica un fragmento de 304 pb del gen codificante de la β-toxina. Las condiciones establecidas fueron una desnaturalización inicial de 95°C por 5 min., seguidos por 30 ciclos de 95°C por 30 seg., 55°C por 30 seg. y 70°C por 20 seg. Por último, una extensión final a 70°C por 5 minutos.

La electroforesis se efectuó sobre gel de agarosa 1,5% (Biodynamics) y la visualización de los productos de amplificación en foto documentador marca Syn-Gen, modelo GBox XT-4, calibrado para lectura de productos teñidos con Sybr-Green I.

Medidas de control a campo
Además de vacunar con una vacuna clostridial polivalente* que incluye toxoide Alfa de C. novyi, se realizó una anamnesis completa del tambo para tratar de identificar qué elementos podían estar relacionados con la presentación del cuadro descripto, intentando averiguar el o los factores predisponentes del mismo.

Resultados

Observación microscópica
En las improntas de músculo teñidas con la coloración de Gram se observaron bacilos grandes, Gram positivos. No se observaron bacilos pleomórficos compatibles con C. chauvoei.

Procesamiento de muestras y técnicas de siembra
De la muestra de músculo en agar sangre se obtuvieron colonias grandes, de bordes irregulares, hemolíticas y en agar yema de huevo se detectó la producción de lecitinasa y de lipasa. La observación microscópica de las colonias, al igual que en el caldo Tarozzi, mostró bacilos grandes, Gram positivos, esporulados compatibles con Clostridium novyi.

Inoculación experimental
El cobayo inoculado se sacrificó antes de las 24 horas. En la necropsia se observó presencia de edema gelatinoso característico de la toxina Alfa de Clostridium novyi, similar al observado en los bovinos afectados.

Tipificación por seroneutralización
La clasificación de C. novyi en tipos A, B y D (C. haemolitycum) se basa en la producción de 2 toxinas mayores, Alfa y Beta. El tipo A produce solamente toxina Alfa, el B produce ambas y C. haemolitycum produce solamente toxina Beta.

Mediante la técnica de seroneutralización se determinó la presencia de la toxina Alfa

Reacción de PCR
Se amplificó un fragmento de 252 pb perteneciente al gen que codifica la producción de toxina Alfa de C.novyi. No se amplificó el fragmento correspondiente al gen que codifica la toxina Beta, confirmando los resultados bacteriológicos (Lipasa +) y de seroneutralización que demuestran que el aislamiento es un C. novyi tipo A (foto 3).


Foto 3: Electroforesis en gel de agarosa de los productos de PCR para toxinas α y β. Calle 1, ladder 100 pb; 2, Muestra fragm. 252pb α-tox.; 3, Muestra frag. 304pb β-tox; 4, Cl. novyi tipo A (C+ α-tox); 5, Cl. haemolyticum (C+ β-tox); 6, Control neg. 

Discusión
Rápidamente se descartó el primer diagnóstico presuntivo de mancha por las categorías afectadas, el edema gelatinoso en las lesiones y la coloración de Gram en las improntas de músculo.

La aparición pocos días después del parto podía deberse a contaminación de heridas internas producto de terneros grandes o partos distócicos, lo cual fue descartado.

También se pensó en una gangrena de tipo endógeno a C. novyi tipo B, producto de traumatismos y golpes que sufren los animales al ingresar al ordeñe, particularmente las vaquillonas en su primera lactancia, sin experiencia previa.

La confirmación de C. novyi tipo A en estas condiciones llevó a profundizar en la anamnesis para intentar descubrir los factores desencadenantes del cuadro.

C. novyi tipo A se asocia con gangrenas de tipo exógeno, es decir, que las esporas presentes en el suelo o materia fecal ingresan a través de heridas, procedimientos quirúrgicos sin condiciones de asepsia o aplicación de inyecciones con productos o elementos contaminados con esporos. 

La anamnesis mostró que “algunas vacas” habían recibido oxitocina y diuréticos (para controlar el edema de ubre), aplicados por vía intramuscular en los miembros posteriores.

Se han observado cuadros similares de gangrenas gaseosas fulminantes a C. septicum en vacas lecheras por aplicación de medicamentos por vía intramuscular con jeringas y agujas no estériles (Koval, A., datos no publicados).

Sterne y Batty en su libro “Clostridios Patógenos” son contundentes: “una cantidad de gérmenes que serían totalmente inocuos por vía subcutánea pueden ser mortales en 24 horas si se introducen por vía intramuscular”.

El microorganismo aislado y la investigación del caso nos permiten afirmar que la causa que originó la muerte de los animales fue la aplicación de productos inyectables sin las debidas condiciones de asepsia.

Utilizar y reutilizar jeringas y agujas y aplicar inyectables sin condiciones mínimas de asepsia son prácticas comunes en el campo y generalmente no tienen consecuencias. Sin embargo, la presentación esporádica de casos como el descripto debe llamar a la reflexión, por la importancia de las pérdidas económicas asociadas.

Existe una serie de prácticas básicas a mejorar en muchos establecimientos. Se recomienda aplicar los inyectables por vía subcutánea y de utilizar la vía intramuscular, hacerlo en la tabla del cuello previa desinfección de la zona, utilizando elementos descartables nuevos y desecharlos luego de su uso.

En cuanto a elementos no descartables como las jeringas multidosis, lavar, desinfectar y lubricar después de vacunar y guardarlas en contenedores herméticos que permitan mantenerlas limpias hasta su próximo uso. Hervir las agujas que no son descartables y acondicionarlas en recipientes de modo que no se llenen de tierra.

Son prácticas simples, que deben ser transmitidas claramente al personal para comprender que las buenas prácticas en el uso y aplicación de medicamentos son fundamentales para prevenir la muerte de animales por este tipo de enfermedades.

Bibliografía 

1-Radostits, O., Gay C., Blood, D.C. Tratado de enfermedades del ganado bovino, ovino, porcino, caprino y equino, 9º ed. (2002).

2-Microbiología Veterinaria. Stanchi N y col. Cap.54 “El Género Clostridium”670-687. Ed. Inter Médica, 2º ed. 2019.

3-Bentancor, L., Lúquez, R. 1990. Empleo de ratones para la prueba de potencia de vacunas contra el carbunclo sintomático. Vet.Arg. (1990). VII (70): 683-685.

4-SENASA, Resol 988/04.- Red de Laboratorios autorizados -Controles de Esterilidad, Inocuidad y Eficacia Vacunas Bacterianas. Set. 1994.

5-Sterne, M., Batty, I. Clostridios Patógenos (1978). Editorial Acribia.

6-Popoff M, Bouvet P. Clostridial toxins. Future Microbiol. 2009; 4:1021-64.